Investigations

Fireworks of autoimmunity from birth Investigations

Investigations

[table id=213 /]

EKG: normal

Upper gastrointestinal endoscopy with duodenal biopsy:

  • normal visual aspect
  • total villous atrophy and dense infiltrate of plasma cells and T cells
duodenal biopsy
Figure 1: Duodenal biopsy

 

Analysis of CD4+ cells by flow cytometry
Figure 2: Analysis of CD4+ cells by flow cytometry

 

Sequencing of the transcription factor FOXP3
Figure 3: Sequencing of the transcription factor FOXP3 (Forkhead box protein P3) gene: hemizygous missense mutation in FOXP3 gene: c.1016 C>A, ( p.P339H)

Wild-type sequence:      ACCCCCTTTCACCTACGCCACGC

Mutated sequence:        ACCCCATTTCACCTACGCCACGC

 

Conclusion of investigations:

  • normocytic anaemia with positive Coombs test: autoimmune haemolytic anaemia
  • platelet and white cell count: normal
  • ion and renal parameters: stigmata of dehydration with mild functional renal failure
  • cortisol and thyroid: normal
  • dosage of complement: normal
  • immunoglobulins: hyperIgE
  • anti-islet, anti-GAD65 and anti-insulin autoantibodies: autoimmune (type 1) diabetes mellitus
  • villous atrophy and intestinal inflammatory infiltrate, anti-enterocyte KD75 autoantibodies, persistent watery diarrhoea: autoimmune enteropathy
  • counts of CD3+CD4+ T cells, CD3+CD8+ T cells and B cells: normal
  • count of CD4+/CD25hi/FOXP3+ T cells: < 0.1%
  • count of CD25+/CD127low T cells: < 0.1%
  • hemizygous mutation in FOXP3
Previous Module
Back to Course
Next Module